Etiologi dan Diagnosa Penyakit Flu Singapura

www.sehatfresh.com

SehatFresh.com – Flu singapura merupakan suatu infeksi yang diakibatkan oleh virus RNA yang disebut picornaviridae atau enterovirus. Penyakit ini dalam kedokteran disebut dengan penyakit Hand, Foot and Mouth Disease (HFMD). Di Indonesia penyakit ini dikenal dengan penyakit, Tangan, Kaki dan Mulut (PTKM).

Penyakit ini lebih sering menyerang bayi, anak di bawah 5 tahun dan terkadang terjadi pada anak umur 10 tahun. Penyebab terjadinya PTKM yaitu infeksi virus RNA yang tergolong dalam famili picornaviridae dan genus enterovirus. Terutama jenis virus Coxsackie A dan tipe A16.

Enterovirus adalah jenis virus yang berada di dalam saluran pencernaan dan diisolasi dari tenggorokan atau usus bawah. Jenis virus ini bersifat sitopatogenik yang dapat tumbuh pada suhu 360C sampai 370C. Golongan coxsackievirus yang masuk ke dalam genus Enterovirus yaitu kelom A dan B. Kelompok coxsackievirus A serotipe dapat menyebabkan penyakit konjungtivitas, hemoragik akut, herpangina dan penyakit tangan, kaki dan mulut (PTKM).

Sedangkan kelompok coxsackievirus B dapat mengakibatkan penyakit pleurodinia, miokarditis, perikarditis dan meningoensefasilitis. Sedangkan penyebab tersering terjadinya penyakit PTKM atau flu singapura yaitu kelompok Coxsackievirus A16. Sedangkan jenis penyakit flu singapura yang tergolong dalam kondisi yang berat dan beresiko terjadinya komplikasi dan menyebabkan kematian yaitu jenis flu singapura yang disebabkan oleh virus Enterovirus 71.

DIAGNOSA FLU SINGAPURA

Penyakit PTKM atau flu singapura dapat didiagnosikan berdasarkan sejarah pasien dan pemeriksaan fisik. Selain itu untuk menegakkan diagnosa penyakit flu singapura dapat dilakukan dengan melakukan pemeriksaan laboratorium untuk memeriksa virus coxsackievirus dan enterovirus lainnya. Penyakit ini sering keliru dengan penyakit kerongkongan yang ditandai dengan sakit tenggorokan dan demam.

Ada sebagian orang juga yang menganggap penyakit ini keliru dengan cacar air karena menimbulkan lepuh pada kulit bagian epidermis. Untuk melakukan pemeriksaan laboratorium dapat menggunakan semepl tinja, cairan serebrospinal, usap rektal, vesikel dikulit biopsi otak dan usap mulut atau tenggorokan.

Sampel yang telah diambil akan dikirim ke Hank Virus Transport. Kemudian virus akan di isolasikan dengan cara biakan sel dengan suckling mouse inoculation. Dan setelah dilakukan tissue culture virus dapat teridentifikasi strainnya dengan antisera tertentu.

Berikut ini beberapa cara untuk menegakan diagnosa penyakit flu singapura, antara lain :

  • Diagnosa laboratorium
  1. Deteksi virus. Terdapat 3 macam deteksi virus diantaranya immuno histochemistry (in situ), imunofluoresensi antibodi (indirect), dan isolasi dan identifikasi virus.
  2. Deteksi RNA. Deteksi RNA terdiri dari RT-PCR Primer yaitu 5’ CTACTTTGGGTGTCCGTGTT 3’ 5’ GGGAACTTCGATTACCATCC 3’ Partial DNA sekuensing (PCR Product)
  3. Serodiagnosis. Pengujian serokonversi dilakukan untuk menentukan PTKM disebabkan oleh Coxsackie A16 atau Enterovirus 71 dengan dilakukan uji serum netralisasi terhadap virus tersebut.
  • Diagnosa banding

Menegakan diagnosa PTKM dilakukan dengan melakukan uji banding diantaranya yaitu stomatitis aphtosa, chickenpox, Eritema multiform dan Herpes simplex. (KMY)

TINGGALKAN KOMENTAR

Please enter your comment!
Please enter your name here